Menu fechado

L1CAM mouse monoclonal antibody, clone UMAB47, 100 uL/ 30 uL

R$8.063,10

Imunógeno Proteína recombinante humana de comprimento total de L1CAM humana (NP_000416) produzida na célula HEK293T.
Aplicações  IHC 1:100,
Aplicações2 IHC
Resumo A proteína codificada por este gene é uma glicoproteína axonal pertencente à família dos supergenes das imunoglobulinas. O ectodomínio, que consiste em vários domínios do tipo imunoglobulina e repetições do tipo fibronectina (tipo III), está ligado através de uma única sequência transmembranar a um domínio citoplasmático conservado. Esta molécula de adesão celular desempenha um papel importante no desenvolvimento do sistema nervoso, incluindo a migração e diferenciação neuronal. Mutações no gene causam três síndromes neurológicas ligadas ao X conhecidas pela sigla CRASH (hipoplasia do corpo caloso, retardo, afasia, paraplegia espástica e hidrocefalia). O splicing alternativo de um éxon específico do neurônio é considerado funcionalmente relevante.
Formulação PBS (pH 7.3) contendo 1% BSA, 50% glicerol e 0.02% azida sódica.
Purificação Purificado a partir de fluidos de ascite de camundongo por cromatografia de afinidade
Isotipo IgG1
Reatividade Humano
Hospedeiro Camundongo
Tamanho 137.8 kDa
Tipo UltraMAB
Concentração 1.00mg/ml
SKU: UM500043 Categoria: Tag:
J Exp Clin Cancer Res    |    Jul 6, 2018    |    PubMed ID: 29980240    |    Read Article
Endometrial cancer prognosis correlates with the expression of L1CAM and miR34a biomarkers
Giacomo Corrado, Valentina Laquintana, Enrico Vizza
Article Snippet

“Primer sequences to perform RT-qPCR were: L1CAM: Fw-5’ACGAGGGATGGTGTCCACTTCAAA,.. Antibody and immunohistochemistry The mouse monoclonal antibody anti-L1CAM, clone UMAB48, was purchased from OriGene Tchnologies (Rockville, MD, USA).. The formalin fixed paraffin-embedded (FFPE) tissue blocks were collected and …”

 

J Cancer Res Clin Oncol    |    Jan 2, 2021    |    PubMed ID: 33387039    |    Read Article
The role of clinical factors and immunocheckpoint molecules in the prognosis of patients with supratentorial extraventricular ependymoma: a single-center retrospective study
Liguo Wang, Song Han, Zhiqiang Li
“The FFPE tissue slides from the 48 samples were immunostained by a two-step method.. Anti-PD-L1 antibodies ((E1L3N) XP Rabbit mAb, 1:200; Cell Signaling Technology, Danvers, MA, USA), anti-PD-1 antibodies ((D4W2J) XP Rabbit mAb, 1:200; Cell Signaling Technology, Danvers, MA, USA), anti-L1CAM antibodies ((OTI10C12) XP Mouse mAb, 1:50; OriGene Technologies, Rockville, MD, USA), anti-Ki-67 antibodies ((MIB-1) XP Mouse mAb, 1:200; OriGene Wuxi Biotechnology Co, Wuxi, Jiangsu, CHN), and a DAB Detection Kit (Polymer) (PV-6000-D, ZSGB-BIO, Beijing, China) were used.. Five fields were selected randomly in each case by ×400 magnification, and then the percentage of positive cells (PPC) and staining intensity (SI) were assessed using Image-pro.. “

Avaliações

Não há avaliações ainda.

Seja o primeiro a avaliar “L1CAM mouse monoclonal antibody, clone UMAB47, 100 uL/ 30 uL”

O seu endereço de e-mail não será publicado.