J Exp Clin Cancer Res | Jul 6, 2018 | PubMed ID: 29980240 | Read Article
Endometrial cancer prognosis correlates with the expression of L1CAM and miR34a biomarkers
Giacomo Corrado, Valentina Laquintana, Enrico Vizza
|
Article Snippet
“Primer sequences to perform RT-qPCR were: L1CAM: Fw-5’ACGAGGGATGGTGTCCACTTCAAA,.. Antibody and immunohistochemistry The mouse monoclonal antibody anti-L1CAM, clone UMAB48, was purchased from OriGene Tchnologies (Rockville, MD, USA).. The formalin fixed paraffin-embedded (FFPE) tissue blocks were collected and …”
J Cancer Res Clin Oncol |
Jan 2, 2021 | PubMed ID: 33387039 |
Read Article
The role of clinical factors and immunocheckpoint molecules in the prognosis of patients with supratentorial extraventricular ependymoma: a single-center retrospective study
Liguo Wang, Song Han, Zhiqiang Li
“The FFPE tissue slides from the 48 samples were immunostained by a two-step method.. Anti-PD-L1 antibodies ((E1L3N) XP Rabbit mAb, 1:200; Cell Signaling Technology, Danvers, MA, USA), anti-PD-1 antibodies ((D4W2J) XP Rabbit mAb, 1:200; Cell Signaling Technology, Danvers, MA, USA), anti-L1CAM antibodies ((OTI10C12) XP Mouse mAb, 1:50; OriGene Technologies, Rockville, MD, USA), anti-Ki-67 antibodies ((MIB-1) XP Mouse mAb, 1:200; OriGene Wuxi Biotechnology Co, Wuxi, Jiangsu, CHN), and a DAB Detection Kit (Polymer) (PV-6000-D, ZSGB-BIO, Beijing, China) were used.. Five fields were selected randomly in each case by ×400 magnification, and then the percentage of positive cells (PPC) and staining intensity (SI) were assessed using Image-pro.. “
Avaliações
Não há avaliações ainda.